Molecular Analyses used in GeneticDiversity Studies of Bioactive Plants ofVerbenaceae and Lamiaceae: A Review

Fabiany de Andrade Brito, Renata Silva-Mann, Daniela Aparecida de Castro Nizio, Maria de Fátima Arrigoni-Blank and Arie Fitzgerald Blank*

Department of Agronomic Engineering, Federal University of Sergipe, Brazil

Submission: July 28, 2018; Published: August 27, 2018

*Corresponding author: Arie Fitzgerald Blank, Department of Agronomic Engineering, Federal University of Sergipe, São Cristóvão, Sergipe,Tel: +557931946981; Email: arie.blank@gmail.com

How to cite this article: Arie F B, Fabiany d A B, Renata S-M, Daniela A d C N, Maria d F A-B. Molecular Analyses used in Genetic Diversity Studies ofBioactive Plants of Verbenaceae and Lamiaceae: A Review . Ann Rev Resear. 2018; 3(2): 555607. DOI: 10.19080/ARR.2018.03.555607

Abstract

Morphological traits used to be employed to differentiate plant genotypes within breeding programs. With the advancement of biotechnology, biochemical markers and DNA molecular markers have become the primary tools used in the differentiation of individuals, because these markers are not influenced by the environment, as it occurs with morphological traits. Consequently, these new techniques provide faster and more precise results. The isoenzymes and the DNA molecular markers RFLP, RAPD, AFLP, and SSR stand out among the biochemical and molecular markers. Each molecular marker presents advantages and limitations, which increases the applicability to different species and laboratory conditions, presenting more reliable results when used in association. Given the increase in the number of works related to bioactive plant species, this review seeks to present the panorama of the use of biochemical and molecular markers in studies on the genetic diversity involving the families Verbenaceae and Lamiaceae, which encompass a large number of medicinal and aromatic species of economic importance.

Keywords: Medicinal and aromatic plants; Genetic resources; Germplasm; Isoenzymes; Genetic markerss

Abbrevations: RFLP: Restriction Fragment Length Polymorphism (RFLP); RAPD: Random Amplified Polymorphic DNA (RAPD); SCAR: Sequence Characterized Amplified Region; SSR: Simple Sequence Repeats; ISSR: Inter-Simple Sequence Repeat; AFLP: Amplified Fragment Length Polymorphisms; PCR: Polymerase Chain Reaction

Introduction

The identification of plant individuals is usually based on the evaluation of morphological and physiological traits, denominated descriptors [1]. These descriptors are usually influenced by abiotic factors, hindering the identification of sufficient characteristics to discriminate genotypically distinct individuals [2].

Biochemical and molecular markers, which are methodologically more specific, have been used in studies on human beings and can also be applied to forensic genetics for providing high-accuracy information [3]. The automation of molecular techniques, provided by the development of the methodology of in vitro amplification of the genetic material by polymerase chain reaction (PCR), led to molecular markers related to the genomic DNA. These markers allow the identification of polymorphism from the amplification of DNA sequences with different sizes, depending on the technique employed. Therefore, these tools provide more efficient discrimination, mainly between morphologically identical but genetically different individuals

Molecular markers can be defined as tools that utilize molecules present in an organism to detect genetic variations. Among these molecules, markers based on variations at the DNA level present greater polymorphism between morphologically-relatedindividuals [4]. There are several types of molecular markers, each one with its advantages and restrictions. They are indicated for specific cases, always considering the available infrastructure. Among the DNA markers available, the Restriction Fragment Length Polymorphism (RFLP), Random Amplified Polymorphic DNA (RAPD), Sequence Characterized Amplified Region (SCAR), Simple Sequence Repeats (SSR), Inter-Simple Sequence Repeat (ISSR), and Amplified Fragment Length Polymorphisms (AFLP) are the most frequently used.

The association of molecular markers with other types of genetic markers is useful for allowing the characterization of various biological materials, generating a potential tool for the characterization of plant germplasm. The families Verbenaceae and Lamiaceae, which hold a large number of species of economic and medicinal importance, can be characterized by markers. These families are made up of bioactive species with several biological properties and are used both in folk medicine and in the drug, food, perfume, and cosmetic industries [5]. Much of this bioactivity is related to the presence of secondary metabolites, such as the essential oils. Essential oils are constituted by a variety of compounds, mostly mono and sesquiterpenes. Biotic and abiotic factors can influence their composition. These metabolites can be used to distinguish individuals belonging to the same botanicalfamily due to the ability of a given group to synthesize a particularset of substances absent in another genus. However, they are notsufficient to genetically differentiate individuals with the samechemical profile within the same species. Morphologically-similarplants with the same chemical profile may not present the samegenotypic constitution. Thus, the essential oils can assist studieson the genetic diversity of populations of the same species.Nevertheless, these metabolites are the result of genetic andenvironmental factors and/or the interaction between them. Inthis sense, molecular markers are an essential tool to complementstudies related to these families since they allow the directassessment of variations in the level of nitrogenous bases in plantgenomes, providing more precise information.

Family Verbenaceae

The family Verbenaceae J.St.-Hil. comprises approximately36 genera and 1000 species. It has a pantropical distribution,occurring mostly in in tropical and temperate zones [6-7]. Brazilholds approximately 16 genera and 250 species [8]. The presenceof glandular trichomes, which produce essential oils of greatmedicinal importance, is a marked characteristic of this family.Some genera have stood out owing to their medicinal uses, such asLantana, Stachytarpheta, and Lippia [9-10].

The use of chemical markers has been reported for the genusLantana in an analysis of 15 species, revealing (E)-caryophylleneas the major compound and phellandrene, cubebene, and elixeneas minor compounds. However, (E)-caryophyllene was notdetected as the major compound in the genus Lippia. Instead,studies suggested that species belonging to the genus Lippiacontain limonene, citral, carvacrol, β-myrcene, camphor, andthymol as their main chemical markers. In addition to essentialoils, other secondary metabolites can be used to distinguishgenera or families. A taxonomic study of four genera of the familyVerbenaceae (Lippia, Lantana, Aloysia, and Phyla) proposed thepresence of iridoid glycosides as a taxonomic descriptor for thisfamily [11-12].

The genus Lippia contains approximately 200 taxa and 160species of herbs, shrubs, and small trees, many of which are richin essential oils [10,13-14]. These plants are widely distributedin Tropical Africa, Mexico, Central America, Paraguay, Argentina,and Brazil, accounting for approximately 70-75% of the species.Many of the Brazilian species are endemic and are concentratedin the Serra do Espinhaço, Minas Gerais, and Goiás, where theygrow between rocks. Due to their characteristics and to anthropicactivities in these regions, such as mining, these endemic speciesare endangered [7,10,15]. Despite being spread all over theBrazilian territory, reports on the genus Lippia are concentratedin species popularly used in the northeastern region of thecountry. Some of them have been included in the official programsof primary health care [16], with emphasis on the species Lippiaalba (Mill.) N.E. Br. and Lippia sidoides Cham. Moreover, the latteroccurs nation-wide.

Family Lamiaceae

The family Lamiaceae is the largest of the order Lamiales, anorder that includes between 20 and 30 families. Studies on themorphology, chemistry, and molecular phylogeny have changedthe classification of this family, resulting in the addition of a largenumber of genera that had originally been classified in the familyVerbenaceae. As a result, the family has about 240 genera and7,200 species, occurring in tropical and temperate areas aroundthe world. Currently, 32 genera and approximately 496 species arenative to Brazil, although this number is constantly changing dueto new discoveries. Seven subfamilies have been recognized, fiveof which occur in South America. The main genera of the familyLamiaceae native to Brazil include Vitex, Aegiphila, Amasonia,Rotheca, Clerodendrum, Volkameria, Scutellaria, Leonurus, Leucas,Leonotis, Ocimum, Marsypianthes, Hypenia, Eriope, Hyptidendron,Hyptis, and Heltodon [17,18,19].

This family consists mainly aromatic herbs and shrubsthat contain essential oil secretory glands. The plants presentquadrangular stems and opposite leaves, and the inflorescenceshave raceme aspect [20].

This family is one of the most diverse and generalized regardingethnomedicine, and its medicinal value is due to the concentrationof volatile oils, which are important for the pharmaceutical,perfumery, cosmetics, pesticides, and flavoring industries [4,21].Medicinal plants have socio-cultural, spiritual, and medicinalvalue in rural and tribal lives of developing countries [22]. Peoplefrom all over the world use between 50,000 and 80,000 plants formedicinal purposes [23].

Isoenzymatic Molecular Markers

Isoenzymatic markers were the first ones to be used inmolecular differentiation between individuals. Despite theirpioneering nature, these markers are usually employed toobtain information related to genetic variability levels in naturalpopulations [24].

From the information contained in the genomic DNA, with thetranslation process, reading of the sequence of messenger RNA(mRNA) for protein synthesis occurs, using polymerization inamino acids peptide bonds. Among the proteins formed, those withcatalytic function are denominated enzymes, being responsible forcatalyzing reactions in an organism in the presence of a specificsubstrate. Some of these enzymes may have the same affinity fora given substrate but different molecular weights, i.e., they aremolecularly distinct enzymes, denominated isoenzymes. Despitehaving the same catalytic functions, they can be biochemicallydifferentiated [25]. Thus, the electrophoresis analysis allowsto visualize and genetically discriminate the isoenzymaticdifferentiation between individuals, species, and populations.

The isoenzymatic discrimination and its applications haveexpanded in plant genetics research, and the investigation of thepatterns of genetic variability is one of its main characteristics[24,26]. Wild barley [27] and wheat [28] were some of the first studies related to genetic discrimination by isoenzymes. Regardingbioactive plants, two populations of Ocimum nudicaule were thefirst ones to be analyzed by isoenzymes [29].

The identification of variability levels enables the evaluationof the genetic structure in natural populations, which increasesthe efficiency of plant breeding programs and helps the study onthe conservation of native genetic resources [30]. For instance,when assessing the genetic diversity of the endangered speciesDracocephalum austriacum, high genetic diversity was identifiedwithin populations, which allowed selecting populations that weresuitable for genetic diversity conservation [31] and genotypesthat could work as parents in future breeding programs.

The diversity and genetic structure of 25 natural populationsof Thymus capitatus, an ornamental plant of the Mediterraneanregion, were analyzed by eight isoenzymes [32]. Elevenpolymorphic loci were detected, and many of them showed rarealleles. These results corroborate studies on isoenzymatic diversityusing other species of the family Lamiaceae [33-34]. Differentiationand genetic similarities between populations indicate they haverecently been isolated by anthropogenic pressure. However,based on the authors’ estimates, most populations showed highvariation, suggesting that the populations constitute suitablegermplasm for conservation and use in breeding programs.

Seven natural populations of Teucrium polium were assessedusing isoenzymes and RAPD regarding their diversity and geneticstructure. The genetic profile within the population had similarresults for both markers. Forty-six electrophoretic bands weredetected by seven isoenzymes, and 144 loci were amplifiedby eight RAPD primers [35], proving to be promising tools forgenotypes characterization.

Despite their efficiency, isoenzymatic markers are limited bythe reduced coverage. Only a small number of loci can be identifiedby this method. In addition, these enzymes can change dependingon the environmental influence, the plant development stage, andthe tissue analyzed [5].

DNA Molecular Markers

DNA molecular markers emerged aiming at samplingdifferent regions of the genome from the structural and molecularknowledge of the deoxyribonucleic acid.

RFLP (Restriction fragment length polymorphism)

At molecular level, the main difference between twoindividuals is detected from the genetic constitution of eachorganism. This difference is the main characteristic that generatespolymorphisms. From this principle, the Restriction FragmentLength Polymorphism (RFLP) was developed [36], being one of thefirst molecular markers based on the DNA molecule. The detectiontechnique of the RFLPs markers uses restriction enzymes,responsible for cleaving the genomic DNA at distinct but specificpoints, allowing the formation of several fragments, whose sizeswill correspond to the target region of the enzyme. The productgenerated is then separated by electrophoresis, visualized byradioactivity, or stained with fluorochromes. The polymorphismvisualized at the end is generated from mutations and alterationsin restriction sites corresponding to the enzyme used.

The RFLP markers are easily reproducible. They havehigh polymorphism and can differentiate homozygote fromheterozygote individuals. However, the main disadvantage is thelengthy development time and the large amount of high-qualitygenomic DNA [25].

Different species have been the target of studies with RFLP,which aim to characterize the existing variability. Maize was thefirst plant to be studied using RFLP markers [37,38].

Phylogenetic studies carried out in mangroves using RFLPmolecular markers revealed data that favored the classificationof Avicennia spp., Verbenaceae, into another family, Avicenniaceae[39]. Due to the toxicity present in Salvia divinorum, which canprovoke psychotropic hallucinations, the combination of analyticalchemistry and RFLP molecular methods identified samples of S.divinorum, assisting the forensic and toxicological sciences [40].Moreover, when studying the applicability of RFLP markers toSalvia genotyping, researchers correlated molecular results withlevels of essential oil production. However, their results indicatethe need for further studies on the genetic variations of Salvia [41].

The emergence of plant hybrids is a phenomenon that cannaturally occur. Nevertheless, it may affect the performanceand potentiate the extinction of rare species. RFLP markersand morphological analyses were fundamental to distinguishendangered taxa and their hybrids with the exotic plant Lantanastrigocamara.

Lately, the isoenzymatic molecular markers and RFLP havebeen poorly used. Conversely, depending on the species, theymay still be useful [42]. Despite their great collaboration at thebeginning of genetic diversity studies of several plant species, theywere replaced by more modern techniques, which have greaterreproducibility and specificity in accessing species genomes.

SSR (Simple Sequence Repeats)

The SSR microsatellite markers were first described in plantsby Condit & Hubbell [43], who detected the repeats (AC)n and(AG)n. The application of microsatellites as PCR primers wasfirst described by Lieckfeldt et al. [44] and Meyer et al. [45]. Thegenome of eukaryotic species is densely populated by differentclasses, with repeated sequences and little complexity. The termsSimple Sequence Repeats (SSR) or Short Tandem Repeats (STR)were later replaced by Microsatellite Markers [46-47]. Morgante& Olivieri [48] clarified that microsatellites occurred in 34 plantspecies and that AT repeats were the most commonly detectedclass of nucleotide microsatellites. They also found that themicrosatellite markers were more frequent in the plant speciesthan in invertebrates and fungi and less frequent in vertebrates.

Microsatellite markers are formed by sets of tandem repeats(one after another), with length from two to six nucleotides, andoccur between the most polymorphic loci of the genomes [49,50].

Regions containing SSR are individually amplified by PCRusing a pair of specific primers (from 20 to 30 bases), whichcomplement the sequences flanking the microsatellite. In view ofcodominance and multiallelism, microsatellites have the highestgenetic information content, which, together with the need for asmall amount of DNA, makes them the ideal genetic markers forgenetic mapping, with higher efficiency for studies on diversity,varieties protection, and assisted selection [51-54].

To use SSR markers, specific primers for the target speciesmust be developed by constructing genomic libraries, selectingand sequencing positive clones, and designing the primers.Subsequently, amplification with PCR, agarose gel electrophoresis,or polyacrylamide is performed, and then the polymorphism isvisualized by staining with silver or fluorescent (polyacrylamide)or with ethidium bromide solution (under ultraviolet light)(agarose). One of the disadvantages of these markers is the highcost for the development of primers [55,56]. However, primersthat have been developed for a determined species can be usedin another species of the same genus due to microsatellite sitesmaintained between species [25]. These primers are denominatedheterologous primers. Microsatellites are classified according tothe composition of the repeated sequences, as follows: perfectrepeats, without any interruption, such as 12 GTGTGTGTGTGTGT;imperfect repeats, interrupted by bases that do not match themotif, such as GTGTGTGTaGTGTGTT; and compound repeats, atwhich two or more microsatellite repeats (classes) are adjacent toone another, such as GTGTGTGTGTGTCACACACACACA) [5].

A comparative study on the breeding system and geneticstructures of two species of the genus Clerodendrum, using SSRmarkers, resulted in the genetic information and knowledgeabout the taxa, the degree of inbreeding depression, pollen/seeddispersal distance, and pollen genetic diversity on pollinators.In a study on Verbenoxylum reitzii (Verbenaceae), an endemictree of the Brazilian Atlantic Forest, which investigated itsusefulness in population genetic studies, SSR markers revealedhigh polymorphism, acting as a powerful tool for genetic andphylogeographic studies of populations. The marker was effective,providing genetic information for the development of conservationstrategies for the species [57-58].

In a study with Pogostemon cablin, microsatellite primerswere developed to characterize the Active Germplasm Bank ofthe Federal University of Sergipe. Twelve microsatellites weredeveloped, out of which six were polymorphic. The geneticdiversity was efficiently identified, providing new informationfor research on the species, which will subsidize conservationstrategies and open paths to other studies [59].

Previously developed microsatellite markers and nine othersthat were later isolated from Salvia officinalis L., an endemicspecies occurring in only two locations in the Balkan Peninsula,were evaluated. Of the 30 markers tested in the natural population,15 were successfully amplified, allowing the comparison of thegenetic variation between plants. This study also shows the lessergenetic variation of rare species [60].

Genetic variability analysis was carried out betweenpopulations of Minthostachys verticillata collected in Central andNorthwestern Argentina. Ninety-three plants from nine sites wereanalyzed, and results revealed that variability was higher betweenthan within populations. The cluster analysis identified threeclusters. The genetic variability observed in the study was higherthan that represented in previous phytochemical reports, althoughthe plants are found in the large distribution area, with significantanthropogenic action. The Mantel test demonstrated a positiveand significant correlation between genetic and geographicdistance. Applying SSR markers to native species can be useful forthe analysis of natural populations, complementing the chemicalanalysis and developing markers associated with compounds innative species [61].

A study on endangered populations of Origanum compactumrevealed that the Gibraltar strait could have been a plant migrationroute between southern Spain and northern Morocco. Theirisolation may have caused the high population differentiation(Fst = 0.22) and low gene flow (Nm = 0.88). These resultshighlight the importance of developing appropriate conservationstrategies for these species, such as partially restoring the geneflow in fragmented and isolated populations that could be quicklyextinguished. This technique will be useful for future breedingprograms [62].

The genetic diversity and population structure of 18populations of Rosmarinus officinalis, a Mediterranean shrubplant, was analyzed using SSR markers. The authors proposedthat the life history and reproductive characteristics contributemainly to explain the high levels of genetic diversity and the weakpopulation structure. Eleven microsatellite loci were polymorphicin all the 18 populations of R. officinalis, totaling 231 differentalleles [63].

With the development of a genomic library, nine microsatelliteprimers were obtained for Lippia alba and used in thecharacterization of the germplasm of the University of São Paulo.Six of them produced polymorphisms, dividing the germplasm intotwo clusters. The data assists the characterization of germplasmbanks, L. alba breeding programs, and other studies on geneticdiversity and classification of species of the genus Lippia [64].

SSR markers were also developed for Phyla scaberrimato determine the genetic variability and population structurepatterns of the species, totaling 11 primers. Fifty-six alleleswere detected in 48 individuals belonging to three differentpopulations. The mean number of alleles per locus was 5.09,while the polymorphic information content ranged from 0.000 to0.587. The 11 pairs of primers were also tested for amplificationin six species of the genus Lippia. The transferability rate variedfrom four loci in Lippia florida and L. rotundifolia to six loci in L.corymbosa and L. microcephala. The 11 primers set proved to bevaluable tools for population genetic studies in P. scaberrima andin species of the genus Lippia in which primers transferability waseffective [65].

RAPD (Random Amplified Polymorphic DNA)

The Random Amplified Polymorphic DNA was one of the firstmarkers developed after the enhancement of PCR. The RAPDtechnique consists of the use of primers with arbitrary sequences,useful mainly in studies with species that have not been geneticallydescribed. It is a rapid technique and has a high potential to detectpolymorphism even with small amounts of available genomic DNA[66]. In this reaction, the primer pairs with the genomic DNA attwo different sites and complements the DNA template. If theseprimers are located between an amplifiable range-from 300bpto 2.5kb-a DNA product is formed by thermocyclic amplification.Polymorphisms are perceived by the presence or absence ofprimer binding sites and can be detected by agarose gel resolution[67].

Initially, RAPD was used by Williams et al. [68] to constructgenetic maps for several species. Subsequently, according to theneed, RAPD could be adapted to various situations, such as genecoding and identification of resistant genes in plants [69-71]. TheRAPD technique became popular for its simplicity, efficiency, andeasy performance. Moreover, they do not require information onthe previous sequence [72].

The Random Amplified Polymorphic DNA methodology standsout due to its low cost, practicality, demand for small amountsof DNA, and applicability to species whose genetic material isunknown or presents few isoenzymatic polymorphism. The littleknowledge about the genetics of the study species is related to theuse of random primers. These primers amplify several regions ofthe genome without prior knowledge of the DNA sequence [73].Unlike the isoenzymatic markers, whose applicability is relatedto the transcribed regions, RAPD markers have a greater genomerange, amplifying both coding and non-coding regions [74].

The primary limitations of the RAPD technique are the variablereproducibility of results and the limited genetic information perlocus due to its dominant behavior. In other words, the techniquedoes not distinguish heterozygote from homozygote genotypes[25,68].

The RAPD technique was used in a study on the geneticsimilarity and for the construction of fingerprints of a group ofMesona chinensis. Eighteen cultivars and a hybrid were assessedbased on RAPD markers. The study resulted in three primers thatcould completely distinguish the 19 samples and the similarityindex. The subsequent clustering analysis divided the cultivarsinto five clusters. Moreover, the results of the markers revealedcorrelations between regional distributions and parental sources.These data provide useful subsidies for the classification,identification, and cultivation of this species [75].

The genetic variability of 11 populations, corresponding tonine species of the genus Lippia (L. corymbosa, L. diamantinensis,L. filifolia, L. florida, L. hermannioides, L. lupulina, L. rotundifolia,L. rosella, and L. sidoides), found in the Brazilian southeast,was assessed by RAPD molecular markers. The analysis wasperformed using 18 primers, generating 490 fragments, of whichonly one presented monomorphic traits for the individuals. Withthe data generated in the analysis, a dendrogram (UPGMA) wasconstructed with two major clusters. In addition, they observedthat the mean interspecific genetic distances were similar for allspecies and higher than intraspecific genetic distances. This resultconfirms the efficiency of the use of RAPD markers in the analysisof genetic diversity for Lippia species and their contribution toconservation and taxonomic implications [15].

In the Anand region, in Gujarat, India, an efficient protocolfor plant regeneration via organogenesis was developed, whichanalyzed the genetic homogeneity of clonal lines established byrandom amplified polymorphic DNA (RAPD) and ISSR of Vitextrifolia species (family Lamiaceae). After the successful plantregeneration from calli derived from stem, leaf, and petiolesexplants, the genetic analysis was performed using the marker. Atotal of 40 seedlings were analyzed using 60 RAPD primers and 27ISSR primers. Of the 60 RAPD primers, 20 were selected, generating125 countable bands. Meanwhile, for the 27 ISSR primers, 12 wereselected, generating 49 bands. The authors concluded that the useof different explants (stem, leaf, and petiole) is advantageous formass propagation and genetic transformation, confirming theefficiency of the RAPD and ISSR techniques to evaluate the natureof regenerated clones of V. trifolia [76].

To understand the genetic variation of three chemotypesof Lippia alba Mill. (Verbenaceae), the cytogenetic analysis ofpollen viability and the nuclear DNA content were evaluatedby the RAPD technique. The authors observed different ploidylevels and mixoploid individuals. Moreover, the flow cytometricanalysis revealed an increase in the nuclear DNA content thatwas not directly proportional to the ploidy level variation. Fortysevenrandom primers were used, of which ten polymorphicprimers were selected. RAPD markers showed that most of thegenetic variation might be a consequence of mixoploidy. Resultsdemonstrated that chromosomal analysis, quantification ofestimated nuclear DNA, and RAPD markers are excellent tools todetect genetic variation between L. alba chemotypes [77].

Another study applied RAPD molecular markers andcompared ITS sequences to estimate the genetic variability ofVerbena officinalis (Verbenaceae), aiming to generate a preciseauthentication method. Results showed that both techniquesallowed the differentiation of V. officinalis from the rest of thegenus, despite the existing intra-specific variation [78].

Nine Ocimum genotypes naturally cultivated in the DakshinDinajpur district, India, were genetically described by RAPDmarkers, which clearly showed that Ocimum africanum andOcimum basilicum are different species. The authors also pointedout that the morpho-chemical and molecular study can be usedas complementary methods in the description of the genotypediversity within the genus Ocimum for its correct identificationand taxonomic classification [79].

ISSR (Inter-simple sequence repeat)

The Inter-Simple Sequence Repeat markers (ISSR) were firstintroduced by Zietkiewicz et al. [80], where the 3’ terminus of theDNA is anchored, and the primers are used to amplify the inter-SSR sequences or SSR flanking sequences. These markers wereemployed to conduct genetic diversity studies [81].

The method employed by the ISSR markers is based on themicrosatellites. They are dominant and do not differ heterozygotefrom the homozygote individuals. However, they analyze multipleloci in a single reaction. Their primers may be anchored at 5’or3’ termini with one to four degenerate bases, based on DNAamplification by the PCR technique. This technique is simpleand efficient due to its high reproducibility and repeatability,generating high polymorphism degree. Its use has becomeincreasingly common. When using primers anchored at the 5’terminus, the amplification products include the microsatellitesequence and its size variations in the genome, providing ahigher polymorphism degree and a larger number of bands [82].No previous knowledge of the genome is required to use thistechnique. Despite being dominant markers, they can be used toassess multiple loci in a single reaction [83,84].

The limitation of this marker is related to the fact that, for beingdominant, the presence of the band can represent the dominanthomozygote or the heterozygote individual, assuming that theabsence of the band is the recessive homozygote. However, thepresence or absence of the band may be related to the occurrenceof insertions or deletions in the primer binding site [80,85]. ISSRprimers are more robust than RAPD primers for they have a largeranchoring surface and higher annealing temperatures, increasingproducts reproducibility [86].

The chemical and molecular characterization of fifteen speciesof the genus Lantana (Verbenaceae) will assist future studies onthe genetic and chemical evaluation of this species and othergenera belonging to the Verbenaceae family, which should includea larger number of species, aiming at a more complete study onthe chemical, genetic, and taxonomic diversity of these plants [87].

A study with twenty-seven accessions of Lippia alba Mill. fromRio Grande do Sul, Brazil, used ISSR and RAPD markers to evaluatethe genetic variability and the relation between accessions. Thegenetic variability was high when compared with that of otherplant species. The UPGMA method showed a low relation betweenaccessions, and no clusters were formed between accessionsbelonging to the same chemotype. The two markers were efficientto evaluate the genetic diversity in L. alba and may contribute tothe conservation and breeding of the species [88].

Savory herb (Lamiaceae) is one of the most relevant medicinalplants of Iran, which is one of the most significant repositories ofSavory germplasm, accounting for about 16 species of the genusSatureia. Ten different populations of three species (Satureiarechingeri, S. khuzistanica, and S. spicigera) were evaluated fortheir genetic diversity using ISSR. Three primers that producedclear and reproducible fragments were selected, generating 19bands. Results of this study revealed that ISSR markers could beused efficiently in the genetic differentiation of the species [89].

A study on Mentha cervina evaluated the morphological,phytochemical, and genetic differences in 12 populations, aimingto obtain the diversity level between them. The relatively lowgenetic diversity detected in the populations analyzed indicatesthat the maintenance of their evolutionary potential is threatenedif population sizes are maintained and if the habitats are notprotected. The amplification of the 121 individuals by ISSRgenerated 175 bands, corresponding to a mean of 82.4 fragmentsper individual. Of these bands, 171 were polymorphic (97.7%).The genetic diversity of M. cervina at species level is relativelyhigh. Conversely, low genetic diversity was detected at populationlevel [90].

In a study with 13 populations of Perovskia abrotanoides,nine selected ISSR primers produced 119 discernible bands, with80.7% polymorphism. The genetic similarity values betweenpopulations ranged from 0.07 to 0.79, indicating a high level ofgenetic variation. The applicability of ISSR markers to characterizethe populations of Perovskia abrotanoides was compared, being thefirst attempt to use molecular markers to investigate the geneticrelationships of P. abrotanoides populations. The informationgenerated can be useful to improve the agro-morphological andphytochemical traits of this species [91].

In a study aiming at the fast and precise identification ofMentha L. species, ISSR markers were used to estimate the genomesize, determine the inter and intraspecific variation within thegenus Mentha, and describe the relationships between genotypes.Thirty-seven ISSR primers were used, which resulted in theamplification of 333 loci and 100% polymorphism. The number ofbands varied from 13 to 24. Moreover, the UPGMA method dividedthe species into seven clusters. These markers are recommendedfor the identification of Mentha L. species/cultivars duringreproduction, conservation, and germplasm collection [92].

The characterization of the genetic diversity of a nativepopulation of Eplingiella fruticosa of the state of Sergipe, Brazil,using ISSR molecular markers revealed an intermediate geneticdiversity. The 100 plants analyzed, collected in 11 municipalitiesof the state of Sergipe, were evaluated by eight ISSR primers,resulting in 72 informative bands. The clustering analysis by theUPGMA method resulted in three clusters. The smallest geneticdistance occurred between plants EPF94 and EPF96 (0.250), andthe greatest distance was detected between the plants EPF50 andEPF96 (0.9778). The polymorphic information content (0.253)was considered moderately informative. These results can supportthe conservation and use of the genetic resources of Eplingiellafruticosa [93].

AFLP (Amplified Fragment Length Polymorphism)

The Amplified Fragment Length Polymorphism (AFLP)markers are based on the selective PCR amplification of total genomic DNA fragments generated by cleavage, using restrictionenzymes. The methodology combines specificity, resolution,and sampling power by the restriction enzyme digestion, beingfast and practical in detecting polymorphisms. This techniquehas been widely used for fingerprinting and genetic mappingpurposes, especially in cultivated plant species that have low DNApolymorphism [94-95].

AFLP analysis consists of four steps: in the first, the genomicDNA of the individual is cleaved by two restriction enzymes; in thesecond, specific adapters are attached to the ends of the genomicfragments generated by the cleavage; in the third, a fraction of thefragments generated is amplified selectively via PCR, using specificprimers designed to recognize sequences in the adapters; and inthe fourth, the subpopulation of amplified fragments is separatedin high-resolution gel [25,96].

One of the advantages of this technique is the detection of highindices of polymorphisms per reaction; also, no prior knowledgeof the DNA sequence data is required to construct the primers[97]. The disadvantage is the lesser information content per locusdue to the dominant nature of these markers, i.e., they do notdifferentiate homozygote from heterozygote genotypes [25].

The diversity and genetic structure of 14 wild populations ofLippia graveolens located in four distinct regions of SoutheasternMexico were analyzed using AFLP markers. Some parameters, suchas the genetic diversity of Nei (Hj), cluster analysis, and Bayesiananalysis were estimated. The authors observed that thymol hadthe highest genetic diversity in the chemotypic analysis. TheBayesian analysis revealed a low but significant differentiationbetween chemotypes. As for the genetic variability, populationsdominated by individuals of the thymol chemotype presentedhigher diversity (Hj = 0.31-0.25) than populations with exclusivelysesquiterpene chemotype (Hj = 0.058). These results confirm thatthe genetic variability influences the chemical profiles, as well asenvironmental and biotic factors, which play an essential role indetermining the structure and the chemotype of this species [98].

The kinship degree and the genetic variation distributionin Tectona grandis (popularly known as teak) cultivated in Côted’Ivoire, were analyzed using AFLP markers. This species iscrucial in afforestation and is exploited uncontrollably due to thequality of its physical properties. In this work, the AFLP markersdemonstrated a clear differentiation between the populationsintroduced in Côte d’Ivoire, showing that they came from NorthIndia [99].

The species Lippia origanoides is economically significantfor the region of the Chicamocha river basin, in NortheasternColombia, due to the quality of its essential oils and to the factthat its distribution is restricted to the few semi-arid areasof Northern South America. By using AFLP markers and 173individuals sampled from four populations, a relatively highgenetic diversity was detected within populations (Ht = 0,32; I= 0,48). Nevertheless, in populations located at higher altitudes,diversity was significantly lower, probably due to more extremeenvironmental conditions. Therefore, the differences in altitudebetween the Chicamocha river basins seem to be relevant indetermining the genetic structure of this species [100].

The chemical characterization of the essential oil components[by gas chromatography/mass spectrometry (GC/MS)] and thegenetic characterization of 27 cultivars of Ocimum basilicum usingAFLP, revealed differences between the morphotypes evaluated.The GC/MS analysis identified 87 volatiles and five chemotypes.The authors stated that a relationship between a geneticprofile, chemical composition, and morphology characterizesa fundamental step to future breeding programs and the in thecultivation of this species [101].

By the AFLP technique, the genetic diversity between tenaccessions of Mentha (Lamiaceae) represented seven taxa andone interspecific hybrid. Six primer combinations were used,generating 2049 bands, of which 1,779 were polymorphic, 29were monomorphic, and 141 were unique. The authors estimatedthe similarity indices and performed the cluster analysis toconstruct a dendrogram, which revealed the kinship degree of thehybrid “Neerkalka” (CIMAP/C63) with one of the accessions (M.arvensis) [102].

Using this same species and technique, the genetic diversityand the genetic relationships between Mentha accessions wasevaluated, aiming at determining the taxonomy of severalinterspecific hybrids. Therefore, 62 mint individuals representingfive species and three hybrids were evaluated. An average of 40AFLP markers was generated, and the percentage of polymorphismranged from 50% to 60% among all accessions studied. Althoughthe number of mint accessions used in this study represents onlya small sample of the mint germplasm available, the AFLP analysishas the potential to be used with a larger number of accessions[103].

The characterization of essential oil variability and the generalcongruence between the chemotype and the genetic clustering ofwild and cultivated populations of Salvia desoleana using AFLPmarkers suggested the existence of a genetic influence on thechemical composition of its essential oil. This information willhelp the conservation and the improvement of the commercialvalue of S. desoleana [104].

In Teucrium arduini, the AFLP analysis separated thepopulations investigated into two clusters, based mainly onthe geographic distance. The Mantel test revealed that thecorrelation observed between the morphological traits and AFLPwas stronger than that detected between the essential oil profileand AFLP. In addition, the test presented a stronger associationbetween the essential oil profile and geographic position thanbetween the morphological traits and geographic position. Thisstudy contributes to the knowledge of the little-investigated floraof the Western Balkan Peninsula [105].

AFLP markers were used to evaluate the genetic variabilityin populations of Phyla scaberrima by AFLP markers. Three combinations of AFLP primers resulted in 997 markers in asample of 131 individuals from five populations (two populationsfrom Mexico and three from Colombia). The low levels of geneticdiversity detected in these populations showed an urgentmanagement strategy must be developed to recover the geneticvariability of the populations from Mexico and Colombia [106].

Conclusion

Molecular markers have contributed significantly to thegeneration of knowledge on bioactive species of the familiesVerbenaceae and Lamiaceae. Several other studies have alsoapplied the ISSR and SSR markers. Such studies help understandthe population genetic structure of poorly studied species andassist the development of conservation strategies and the futureuse of these genetic resources in breeding programs.

Acknowledgment

The authors thank CNPq, FAPITEC/SE, CAPES, and FINEP fortheir financial support for research in bioactive plants of Sergipe,Brazil.

References

1. Gallacher DJ (1997) Optimised descriptors recommended forAustralian sugarcane germplasm (Saccharum spp. hybrid). Australianjournal of agricultural research 48: 775-779.
2. Giancola S, Poltri SM, Lacaze P, Hopp HE (2002) Feasibility ofintegration of molecular markers and morphological descriptorsin a real case study of a plant variety protection system for soybean.Euphytica 127: 95-113.
3. Benecke M (1997) DNA typing in forensic medicine and in criminalinvestigations: a curren survey. Naturwissenschaften 84(5): 181-188.
4. Borém A, Caixeta ET (2006) Marcadores moleculares. UniversidadeFederal de Viçosa, Viçosa, Minas Gerais, Brasil, pp. 9-66.
5. Ozkan M (2008) Glandular and eglandular hairs of Salvia recognitaFisch. and Mey. (Lamiaceae) in Turkey. Bangladesh Journal of Botany37(1): 93-95.
6. Judd WS, Campbell CS, Kellogg EA, Stevens PF (1999) Plant systematics:a phylogenetic approach. Sunderland: Sinauer Associates.
7. Brandão AD, Viccini LF, Salimena FRG, Vanzela ALL, Recco-Pimentel(2007) Cytogenetic characterization of Lippia alba and Lantana camara(Verbenaceae) from Brazil. J Plant Res 120(2): 317-321.
8. Souza VC, Lorenzi H (2005) Verbenaceae, Botânica sistemática.Instituto Plantarum de Estudos da Flora, Nova Odessa, Brazil, pp. 529-532.
9. Pascual ME, Slowing K, Carretero E, Mata DS, Villar A (2001)Lippia: traditional uses, chemistry and pharmacology: a review. JEthnopharmacol 76(3): 201-214.
10. Viccini LF, Pierre PMO, Praça MM, Costa DCS, Romanel EC, et al. (2006)Chromosome numbers in genus Lippia (Verbenaceae). Plant Systematicand Evolution 256(1-4): 171-178.
11. Sena-Filho JG, Xavier HS, Barbosa JM, Duringer JM (2010) A chemicalmarker proposal for the Lantana genus: composition of the essentialoils from the leaves of Lantana radula and Lantana canescens. NaturalProduct Commun 5(4): 635-640.
12. Rimpler H, Sauerbier AH (1986) Iridoid glucosides as taxonomicmarkers in the genera Lantana, Lippia, Aloysia and Phyla. BiocheminstrySystematic Ecology 14(3): 307-310.
13. Cavalcanti SCH, Niculau ES, Blank AF, Câmara CAG, Araújo IN, et al.(2010) Composition and acaricidal activity of Lippia sidoides essentialoil against two-spotted spider mite (Tetranychus urticae Koch).Bioresour Technol 101(2): 829-832
14. Mendes SS, Bomfim RR, Jesus HC, Alves PB, Blank AF, et al. (2010)Evaluation of the analgesic and anti-inflammatory effects of theessential oil of Lippia gracilis leaves. J Ethnopharmacol 129(3): 391-397.
15. Viccini LF, Costa DCS, Machado MA, Campos AL (2004) Genetic diversityamong nine species of Lippia (Verbenaceae) based on RAPD Markers.Plant Systematic Evolution 246(1-2): 1-8.
16. Lorenzi H, Matos FJA (2002) Plantas medicinais no Brasil: nativas eexóticas cultivadas. Instituto Plantarum, Nova Odessa, Brazil.
17. Harley RM (2012) Checklist and key of genera and species of theLamiaceae of the Brazilian Amazon. Rodriguésia 63(1): 129-144.
18. Harley RM, Atkins S, Budantsev A, Cantino PH, Conn B, et al. (2004)Labiatae. In: Kadereit JW (ed.), The families and genera of vascularplants. Kubitzki, (7th edn), pp. 167-275.
19. Harley RM, França F, Santos EP, Santos JS (2010) Lamiaceae. In:Catálogo de plantas e fungos do Brasil, Jardim Botânico do Rio deJaneiro 2: 1130-1146.
20. Alonso JLF, Díaz OR (2006) Libro rojo de plantas de Colombia. Institutode Ciencias Naturales - Universidade Nacional de, Bogotá, Colômbia.
21. Sarac N, Ugur A (2007) Antimicrobial activities and usage in folkloricmedicine of some Lamiaceae species growing in Mugla, Turkey. EurAsian Journal of BioScience 1: 28-34.
22. Hendawy SF, Ezz El-Din AA, Aziz EE, Omer EA (2010) Productivity andoil quality of Thymus vulgaris L. under organic fertilization conditions.Journal of Applied Science 3: 203-216.
23. Naguib NYM (2011) Organic Vs Chemical Fertilization of MedicinalPlants: A Concise Review of Researches. Advances in EnvironmentalBiology 5: 394-400.
24. Botrel MCG, Carvalho D (2004) Variabilidade isoenzimática empopulações naturais de jacarandá paulista (Machaerium villosum Vog.).Revista Brasileira de Botânica 27(4): 621-627.
25. Ferreira ME, Grattapaglia D (1998) Introdução ao uso de marcadoresmoleculares em análise genética. (3rd edn), Embrapa-Cenargen,Brasília, pp. 220.
26. Pinto SIC, Souza AM, Carvalho D (1978) Variabilidade genéticapor isoenzimas em populações de Copaifera langsdorffii em doisfragmentos de mata ciliar. Scientia Forestalis 40-48.
27. Brown AH (1978) Isozymes, plant population genetic structure andgenetic conservation. Theor Appl Genet 52(4): 145-157.
28. Jaaska V (1980) Electrophoretic survey of seedling esterases in wheatsin relation to their phylogeny. Theor Appl Genet 56(6): 273-284.
29. Figueiredo-Ribeiro RCL, Almeida VP (1986) Análise enzimáticaequimiotaxonomia de duas variedades de Ocimum nudicaule Benth.Revista Brasileira de Botânica 9(1): 75-80.
30. Oliveira F, Carvalho D, Rosado SCS (2002) Taxa de cruzamento e sistemareprodutivo de uma população natural de Copaifera langsdorffii Desf.na região de Lavras (MG) por meio de isoenzimas. Revista Brasileira deBotânica 25(3): 331-338.
31. Dostálek T, Münzbergová Z, Plačková I (2009) Genetic diversity andits effect on fitness in an endangered plant species, Dracocephalumaustriacum L. Conservation Genetics 11(3): 773-783.
32. Ali IBEH, Guetat A, Boussaid M (2012) Genetic diversity and structureof wild Tunisian Thymuscapitatus (L.) Hoffm. et Link. (Lamiaceae) assessed using isozyme markers. African Journal of Ecology 50(2):140-151.
33. Fadhel NB, Boussaïd M (2004) Genetic diversity in wild Tunisianpopulations of Mentha pulegium L. (Lamiaceae). Genetic Resources andCrop Evolution 51(3): 309-321.
34. Zaouali Y, Boussaid M (2008) Isozyme markers and volatiles inTunisian Rosmarinus officinalis L. (Lamiaceae): A comparative analysisof population structure. Biochemical Systematics and Ecology 36(1):11-21.
35. Boulila A, Béjaoui A, Messaoud C, Boussaid M (2008) Variation ofvolatiles in Tunisian populations of Teucrium polium L. (Lamiaceae).Chemistry and biodiversity 5(7): 1389-1400.
36. Botstein D, White LR, Skolnick M, Davis RW (1980) Constructionof a genetic link a gemap in manusing restriction fragment lengthpolymorphisms. Am J Hum Genet 32(3): 314-331.
37. Smith OS, Smith JS, Bowen SL, Tenborg RA, Wall SJ (1990) Similaritiesamong a group of elite maize in breds as measured by pedigree, F1grain yield, grain yield, heterosis, and RFLPs. Theor Appl Genet 80(6):833-840.
38. O’donoughue LS, Souza E, Tanksley SD, Sorrells ME (1994) Relationshipsamong North American Oat Cultivars Based on Restriction FragmentLength Polymorphisms. Crop Science 34(5): 1251-1258.`
39. Parani M, Lakshmi M, Senthilkumar P, Ram N, Parida A (1998)Molecular phylogeny of mangroves V. Analysis of genome relationshipsin mangrove species using RAPD and RFLP markers. Theoretical andApplied Genetics 97(4): 617-625.
40. Bertea BCM, Luciano P, Bossi S, Leoni F, Baiocchi C, et al. (2006) PCRand PCR-RFLP of the 5S-rRNA-NTS region and salvinorin A analysesfor the rapid and unequivocal determination of. Phytochemistry 67(4):371-378.
41. Karaca M, Ince AG, Ay ST, Turgut K, Onus AN (2008) PCR-RFLP andDAMD-PCR genotyping for Salvia species. Journal Science FoodAgriculture 88(14): 2508-2516.
42. Sousa VA, Filho ANK, Martins EG, Shimizu JY, Albertin F (2018)gene diversity in Grevillea populations introduced in Brazil and itsimplication on management of genetic resources. Revista Árvore42(2): e420205.
43. Condit R, Hubbell SP (1991) Abundance and DNA frequence of 2-baserepeat regions in tropical tree genomes. Genome 34(1): 66-71.
44. Lieckfeldt E, Meyer W, Borner T (1993) Rapid identification anddifferentiation of yeast by DNA and PCR fingerprinting. JBasic Microbiol33(6): 413-426.
45. Meyer W, Lieckfeldt E, Kuhls K, Freedman EZ, Borner T, et al. (1993)DNA and PCR fingerprinting in fungi. In: Pena SDJ, Chakraborty R,Epplen JT, Jeffreys AJ (eds.), DNA Fingerprinting: State of the Science.Birkhauser, Verlag, Switzerland, pp. 311-320
46. Hamada H, Petrino MG, Kakunaga T (1982) A novel repeated elementwith ZDNA forming potential is widely found in evolutionarily diverseeukaryotic genomes. Proc Natl Acad Sci USA 79(21): 6465-6469.
47. Tautz D, Renz M (1984) Simple sequences are ubiquitous repetitivecomponents of eukaryotic genomes. Nucleic Acids Res 12(10): 4127-4138.
48. Morgante M, Olivieri AM (1993) PCR-amplified microssatellites asmarkers in plant genetics. Plant J 3(1): 175-182.
49. Milach SCK (1998) Marcadores moleculares em plantas. UFRGS, PortoAlegre, Brazil, pp. 29-40.
50. Matioli SR (2001) Biologia Molecular e Evolução. Holos, pp. 153-161.
51. Tautz D (1989) Hypervariability of simple sequences as a generalsource for polymorphic DNA markers. Nucleic Acids Res 17(16): 6463-6471.
52. Blair MW, Pedraza F, Buendia HF, Gaitan-Solis E, Beebe SE, et al. (2003)Development of a genome-wide anchored microsatellite map forcommon bean (Phaseolus vulgaris L.). Theor Appl Genet 107(8): 1362-1374.
53. Song QJ, Marek LF, Shoemaker RC, Lark KG, Concibido VC, et al. (2004)A new integrated genetic linkage map of the soybean. Theor Appl Genet109(1): 122-128.
54. Borém A, Caixeta ET (2009) Marcadores Moleculares. (2nd edn), Viçosa,Minas Gerais, Brasil, pp. 532.
55. Faleiro FG, Faleiro ASG, Cordeiro MCR, Karia CT (2003) Metodologiapara operacionalizar a extração de DNA de espécies nativas docerrado. Planaltina: Embrapa Cerrados, pp. 6.
56. Faleiro FG (2007) Marcadores genético-moleculares aplicados aosprogramas de conservação e uso de recursos genéticos. Planaltina, DF:Embrapa Cerrados, pp. 102
57. Mizusawa L, Kaneko S, Hasegawa M, Isagi Y (2011) Developmentof nuclear SSRs for the insular shrub Clerodendrum izuinsulare(Verbenaceae) and the widespread C. trichotomu. American Journal ofBotany, pp. 333-336.
58. Thode VA, Backes A, Mader G, Kriedt R, Bonatto SL, et al. (2013).Development of Microsatellites for Verbenoxylum reitzii (Verbenaceae),a Tree Endemic to the Brazilian Atlantic Forest. Appl Plant Sci 1(8).
59. Sandes SS, Pinheiro JB, Zucchi MI, Monteiro M, Arrigoni-Blank MF, etal. (2013) Development and characterization of microsatellite primersin Pogostemon cablin (Lamiaceae). Genet Mol Res 12(3): 2837-2840.
60. Radosavljević I, Satovic Z, Jakse J, Javornik B, Greguraš D, et al. (2012)Development of New Microsatellite Markers for Salvia officinalis L. andits potential use in conservation-genetic studies of narrow endemicSalvia brachyodon Vandas. Int J Mol Sci 13(9): 12082-12093.
61. Bonafede M, Marsal V, Arteaga M (2014) Diversity distributionanalysis in Minthostachys verticillata Epling (Griseb) (Lamiaceae)(peperina) populations by EST-SSR markers. Journal of Biodiversityand Environmental Sciences (JBES) 5(6): 190-199.
62. Aboukhalida K, Machon N, Lambourdiered J, Abdelkrimd J, Bakhaa M, etal. (2017) Analysis of genetic diversity and population structure of theendangered Origanum compactum from Morocco, using SSR markers:Implication for Conservation. Biological Conservation 212(A): 172-182.
63. Segarra-Moragues JG, Marco YC, Castellanos MC, Molina MJ, García-Fayos P (2016) Ecological and historical determinants of populationgenetic structure and diversity in the Mediterranean shrub Rosmarinusofficinalis (Lamiaceae). Botanical Journal of the Linnean Society180(1): 50-63.
64. Rocha DS, Santos CP, Bajay MM, Campos JB, Blank AF, et al. (2015)Development of a novel set of microsatellite markers for Lippia alba(Verbenaceae). Genet Mol Res 14(1): 971-974.
65. Chaves CL, Ruas EA, Ruas CF, Delfini J, Bejatto NC, et al. (2014) Isolationand characterization of simple sequence repeat markers for theherbaceous species Phyla scaberrima (Verbenaceae). Genet Mol Res13(3): 7864-7868.
66. Lacerda DR, Acedo MDP, Lemos-Filho JP, Lovato MB (2002) A técnicade RAPD: uma ferramenta molecular em estudos de conservação deplantas. Lundiana 3(2): 87-92.
67. Tingey SV, Rafalski JA, Williams JGK (1993) Application of RAPDTechnology to Plant Breeding. In: Neff M (Ed.), ASHS Publishers,Minnesota, USA, pp. 3-8.
68. Williams JGK, Kubelik AR, Livak KJ, Rafalskij A, Tingey SV (1990) DNApolymorphims amplified by arbitrary primers are useful as geneticmarkers. Nucleic Acids Res 18(22): 6531-6535.
69. Michelmore RW, Paran I, Kesseli RY (1991) Identification of markerslinked to disease resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions using segregatingpopulations. Proc Natl Acad Sci USA 88(1): 9828-9832.
70. Delourme R, Bouchereau A, Hubert N, Renard M, Landry BS (1994)Identification of RAPD markers linked to a fertility restorer gene forthe Ogura radish cytoplasmic male sterility of rapeseed (Brassica napusL.). Theor Appl Genet 88(6-7): 741-748.
71. Tanhuanpaa PK, Vikki JP, Vikki HJ (1996) Mapping of QTL for oleic acidconcentration in spring turnip rape (Brassica rapa ssp oleifera). TheorAppl Genet 92(8): 952-956.
72. Sarwat M, Nabi GDS, Srivastava OS (2011) Molecular markers inmedicinal plant biotechnology: past and present. Crit Rev Biotechnol32(1): 1-19.
73. Lacerda DR, Acedo MDP, Lemos-Filho JP, Lovato MB (2002) A técnicade RAPD: uma ferramenta molecular em estudos de conservação deplantas. Lundiana 3(2): 87-92.
74. Fritsch P, Rieseberg LH (1996) The use of Random AmplifiedPolymorphic DNA (RAPD) in conservation genetics. In: Smith TB,Wayne RK. Molecular genetic approaches in conservation. OxfordUniversity Press, New York, USA, pp. 54-73.
75. Zhang GF, Guan JM, Lai XP, Lin J, Liu JM, et al. (2012) RAPD fingerprintconstruction and genetic similarity of Mesona chinensis (Lamiaceae) inChina. Genet Mol Res 11(4): 3649-3657.
76. Samantaray S, Bishoyi AK, Maiti S (2013) Regeneracion de plantas apartir de cultivos de callos de Vitex trifolia (Lamiales: Lamiaceae): unaplanta medicinal potencial. Revista de Biologia Tropical 61(3): 1083.
77. Pierre PMO, Souza SM, Davide LC, Machado MA, Viccini LF (2011)Karyotype analysis, DNA content and molecular screening in Lippiaalba (Verbenaceae). Academia Brasileira de Ciências 83(3).
78. Ruzicka J, Lukas B, Merza L, Göhler I, Abel G, et al. (2009) Identificationof Verbena officinalis Based on ITS Sequence Analysis and RAPDDerivedMolecular Markers. Planta Med 75(11): 1271-1276.
79. Chowdhury T, Mandal A, Roy SC, Sarker DD (2017) Diversity of thegenus Ocimum (Lamiaceae) through morpho-molecular (RAPD)and chemical (GC-MS) analysis. Journal of Genetic Engineering andBiotechnology 15(1): 275-286.
80. Zietkiewicz E, Rafalski A, Labuda D (1994) Genome fingerprinting bysimple sequence repeat (SSR) anchored polymerase chain reactionamplification. Genomics 20(2): 176-183.
81. Souframanien J, Gopalakrishna T (2004) A comparative analysisof genetic diversity in blackgram genotypes using RAPD and ISSRmarkers. Theor App Genet 109(8): 1687-1693.
82. Reddy MP, Sarla N, Siddiq EA (2002) Inter simple sequence repeat(ISSR) polymorphism and its application in plant breeding. Euphytica128(1): 9-17.
83. Goulão L, Oliveira C (2002) Molecular characterization of cultivars ofapple (Malus x domestica Borkh.) using microsatellite (SSR and ISSR)markers. Euphytica 122: 81-89.
84. González A, Coulson M, Brettell R (2002) Development of DNA markers(ISSRs) in mango. Acta Horticulturae 575: 139-143.
85. Culley TM, Wolfe AD (2001) Population genetic structure of thecleistogamous plant species Viola pubescens, as indicated by isozymeand ISSR molecular markers. Heredity (Edinb) 86(Pt 5): 545-556.
86. Tsumura Y, Ohba K, Strauss SH (1996) Diversity and inheritanceof inter-simple sequence repeat polymorphisms in Douglas-fir(Pseudotsuga menziesii) and sugi (Cryptomeria japonica). Theoreticaland Applied Genetics 92(1): 40-45.
87. Sena-Filho JG, Rabbani ARC, Silva TRS, Silva AVCda, Souza IA, et al.(2012) Chemical and molecular characterization of fifteen speciesfrom the Lantana (Verbenaceae) genus. Biochemical Systematics andEcology 45: 130-137.
88. Manica-Cattani MF, Zacaria J, Pauletti G, Atti-Serafini L, EcheverrigarayS (2009) Genetic variation among South Brazilian accessions of Lippiaalba Mill. (Verbenaceae) detected by ISSR and RAPD markers. Braz JBiol 69(2): 375-380.
89. Kameli M, Hejazi SMH, Ebadi M (2013) Assessment of genetic diversityon populations of three Satureja species in Iran using ISSR markers.Annals of Biological Research 4(3): 64-72.
90. Rodrigues L, Póvoa O, Berg CVD, Figueiredo AC, Moldão M, et al. (2013)Genetic diversity in Mentha cervina based on morphological traits,essential oils profile and ISSRs markers. Biochemical Systematics andEcology 51: 50-59.
91. Pourhosseini SH, Hadian J, Sonboli A, Ebrahimi SN, Mirjalili MH(2018) Genetic and chemical diversity in Perovskia abrotanoides KAR.(Lamiaceae) Populations Based on ISSRs Markers and Essential OilsProfile. Chemical Biodivers 15(3): e1700508
92. Jedrzejczyk I, Rewers M (2018) Genome size and ISSR markers forMentha L. (Lamiaceae) genetic diversity assessment and speciesidentification. Industrial Crops and Products 120: 171-179.
93. Silva DC, Diniz LEC, Blank AF, Nizio DAC, Pinto JAO, et al. (2017)Assessment of genetic diversity of a native population of Eplingiellafruticosa: a plant with therapeutic potential. Genet Mol Res 16(3).
94. Vos P, Hogers R, Bleeker M, Reijans M, Lee TV de, et al. (1995) AFLP: anew technique for DNA fingerprinting. Nucleic Acids Res 23(21): 4407-4414.
95. Liu BH (1968) Statistical genomics: linkage, mapping and QTL analysis.CRC Press, New York, USA, pp. 611.
96. Ramalho MAP, Santos JB, Pinto CABP (2000) Genética na agropecuária.UFLA, Lavras, Minas Gerais, Brasil, pp. 472.
97. Faleiro FG, Lopes UV, Yamada MM, Pires JL, Bahia RCS, et al. (2001)Caracterização de variedades clonais de Theobroma cacao L. com baseem marcadores RAPD, AFLP e microssatélites. Agrotrópica 13(2): 79-86.
98. Martinez-Natarén DA, Parra-Tabla V, Ferrer-Ortega MM, Calvo-IrabiénLM (2014) Genetic diversity and genetic structure in wild populationsof Mexican oregano (Lippia graveolens HBK) and its relationship withthe chemical composition of the essential oil. Plant Systematics andEvolution 300(3): 535-547.
99. Fofana IJ, Diarrassouba N, Silue S, Koffi KK, Adou K (2013) Origin ofafrican teak (Tectona grandis) provenances in Côte d’ivoire using AFLPmarkers. Elite Research Journal of Biotechnology and Microbiology1(1): 1-8.
100. Vega-Vela NE, Sánchez MI (2012) Genetic structure along analtitudinal gradient in Lippia origanoides, a promising aromatic plantspecies restricted to semiarid areas in northern South America. EcolEvol 2(11): 2669-2681.
101. Liber Z, Carovic-Stanko K, Politeo O, Strikic F, Kolak I, et al. (2011)Chemical Characterization and Genetic Relationships among Ocimumbasilicum L. Cultivars. Chem Biodivers 8(11): 1978-1989.
102. Shasany AK, Shukla A, Gupta S, Rajkumar S, Khanuja SPS (2005)AFLP analysis for genetic relationships among Mentha species. PlantGenetic Resources 144: 14-19.
103. Gobert V, Moja S, Colson S, Taberlet P (2012) Hybridization in thesection Mentha (Lamiaceae) inferred from AFLP markers. Am J Bot89(12): 2017-2023.
104. Rapposelli E, Melito S, Barmina GG, Foddai M, Azara E, et al. (2015)AFLP fingerprinting and essential oil profiling of cultivated and wildpopulations of Sardinian Salvia desoleana. Genetic Research CropEvolution 62(6): 959-970.
105. Kremer D, Bolaric S, Ballian D, Bogunic F, Steševic D, et al. (2015)Morphological, genetic and phytochemical variation of the endemicTeucrium arduini L. (Lamiaceae). Phytochemistry 116: 111-119.
106. Androcioli LG, Ruas EA, Rodrigues LA, Ruas CF, Perilla HER, et al.(2015) Population genetic structure in Phyla scaberrima fromMexico and Colombia assessed by AFLP markers and implications forconservation. Genet Mol Res 14(4): 15697-15704.